rs2233159 chr19:40777460 C>G
- Sequence
ggccctgccgtttcccctccttgg[C/G]tttatgcaaatacaatcagcccag
- ASB in cell types
- germinal center CD77+ B cells
- ASB for transcription factors
- SPI1_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.38 | 1.30 | 1.19 | n/a | No Hit | |||
| FOXP1_HUMAN | -2.11 | 3.48 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol, infant head circumference, total cholesterol, total cholesterol change with statins
GTEx eQTL Artery_Aorta, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood