rs2233434 chr6:44265183 A>G
- Sequence
tcttccttctcctgtggttccttg[A/G]cgggtcccggaggatgggtgcagg
- ASB in cell types
- primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.96 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aars2 gene expression in lymphoblastoid b cell lines, adiponectin levels, antidepressant efficacy in major depressive disorder remission after 12 weeks of treatment, hdl cholesterol, height, rheumatoid arthritis, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Transverse, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid