rs2234345 chr18:56638636 G>A
- Sequence
cggagcggccgagggggcggggag[G/A]gatgggggaggggagaggaggagg
- ASB in cell types
- monocytes from periferal blood BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- SRBP2_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 2.03 | -4.65 | 2.00 | 1.79 | Weak Discordant | |||
| GCR_HUMAN | 0.31 | 1.10 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
