rs2236142 chr22:28741956 G>C
- Sequence
tcctgggagttgtagtttagaagg[G/C]agagcggaacttagaacccgggtt
- ASB in cell types
- HEK293 (embryonic kidney) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP2_HUMAN | -5.17 | 2.79 | 2.00 | -1.97 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
