rs2236464 chr21:45478260 T>C
- Sequence
cttggagcgtggggtgcatttcca[T/C]gtagacactgtaggtggcgccgga
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte ID00014 (lymphoblastoid cell, DiGeorge syndrome) CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- MGAP_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MGAP_HUMAN | 1.30 | -1.30 | 1.00 | n/a | n/a | |||
| REQU_HUMAN | 1.87 | 0.62 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood