rs2239560 chr1:9244672 G>A
- Sequence
tcctatgctcctggcagcaaagtg[G/A]ttcatctctagcaagtggtctcta
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.93 | n/a | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, college completion, comorbid depressive syndrome and alcohol dependence, height, meningioma, mitral annular calcium, total cholesterol, waist hip ratio, years of education
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Whole_Blood