rs2241718 chr19:41323701 G>A
- Sequence
ctcctgtttacactccccaaatgc[G/A]cacaggctgttatcatgggtcctg
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) MRC-5 (fetal lung fibroblasts) breast tumor
- ASB for transcription factors
- NGN2_HUMAN HTF4_HUMAN TCF21_HUMAN TBX3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NGN2_HUMAN | 1.63 | 0.01 | 1.00 | n/a | n/a | |||
| HTF4_HUMAN | 2.98 | 0.15 | 1.67 | n/a | No Hit | |||
| TCF21_HUMAN | 0.95 | n/a | 3.00 | n/a | n/a | |||
| TBX3_HUMAN | -1.82 | 2.17 | 1.00 | n/a | No Hit | |||
| ESR1_HUMAN | 2.35 | -1.58 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), coronary artery disease (cad)
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Pancreas, Spleen, Stomach, Whole_Blood