rs2242543 chr14:22226436 A>G
- Sequence
agtatctaccatctttcataaaac[A/G]tgtggacactagttttcagctatt
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM02255 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.62 | -1.88 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -1.16 | 1.30 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 1.47 | -0.47 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.72 | -0.58 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -0.81 | 1.21 | 1.00 |
Items per page:
1 – 5 of 5