rs224481 chr4:11440010 A>G
- Sequence
tcaagctggctgatcagaaaaagg[A/G]gaagcctcagaaaggaagtgggat
- ASB in cell types
- THP-1 (acute monocytic leukemia) EOL-1 (Acute myeloid leukemia) monocytes from periferal blood
- ASB for transcription factors
- SPI1_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.04 | 1.48 | 1.63 | 2.67 | Concordant | |||
| SMRC1_HUMAN | -1.37 | 2.40 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
