rs2246083 chr1:202812036 G>A
- Sequence
cttggcaccaggcacgtggcacac[G/A]ctccacaaatatttgttgaaaggg
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- HIF3A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF3A_HUMAN | 2.20 | n/a | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, amyotrophic lateral sclerosis (als) age of onset, college completion, fasting insulin, hip bone mineral density (bmd), homa-ir, ldl cholesterol
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg