rs2247386 chr3:8988234 T>A
- Sequence
atcttcccactttggatggtcatg[T/A]tgcaagttccccaaacagcctctt
- ASB in cell types
- RWPE2 IMR-5 (Neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | 1.87 | -1.66 | 1.00 | |||
| IMR-5 (Neuroblastoma) | -1.46 | 2.50 | 2.00 |
Items per page:
1 – 2 of 2