rs2248637 chr20:45368600 A>G
- Sequence
ggagttgatgctgacaggatgaag[A/G]tttaggaataaatatgcctgggaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -1.78 | 2.18 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder versus schizophrenia, birth weight, comorbid depressive syndrome and alcohol dependence, obesity with early age of onset (age >2), paternal transmission distortion, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), recurrent early onset major depressive disorder (males), transmission distortion
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood