rs224938 chr5:82421357 C>T
- Sequence
tcattgcttcatgttcctaggagg[C/T]atgtatatcaaatactgcaccaga
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.23 | -0.99 | 1.06 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, arthritis including non-rheumatoid, asthma, diastolic blood pressure (dbp), fasting insulin, homa-b, homa-ir, longstanding arthritis, opioid sensitivity, severe diabetic retinopathy