rs225207 chr17:32567706 T>A
- Sequence
ccactgtagggtctcattctttca[T/A]cattcttagtcatcaagtccaagt
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.44 | -0.56 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), college completion, lp-pla2 mass, microalbuminuria, years of education