rs2255988 chr20:1535971 G>C
- Sequence
ccaggctccagccctgacaacctg[G/C]tgattctaggaagcgcacaccatt
- ASB in cell types
- RPMI8226 (Plasma cell myeloma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RPMI8226 (Plasma cell myeloma) | -2.91 | 1.99 | 1.50 | |||
| THP-1 (acute monocytic leukemia) | n/a | 1.27 | 3.00 |
Items per page:
1 – 2 of 2