rs226058 chr16:21301362 A>G
- Sequence
ggggccctttcagggacttggggc[A/G]tagggtagggcgcatgggacgagg
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.27 | 0.72 | 2.00 | |||
| HepG2 (hepatoblastoma) | 1.65 | 0.12 | 2.93 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.92 | 1.63 | 1.00 |
Items per page:
1 – 3 of 3