rs2264306 chr8:11530940 G>A
- Sequence
gctcccaaattgtttcctaaagtt[G/A]tttcgtttcaccttaccatcagcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN MEF2B_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.35 | -0.50 | 1.67 | n/a | n/a | |||
| MEF2B_HUMAN | 1.30 | -0.36 | 1.25 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.53 | -1.93 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP homa-b, ldl cholesterol change with statins, mitral annular calcium, serum creatinine, sporadic creutzfeldt-jakob disease, triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood