rs226822 chr20:48283992 A>C
- Sequence
gccaagaacagccctgctcccttg[A/C]ccacatcaggaaataccgaacatg
- ASB in cell types
- EA.hy 926 (human umbilical vein endothelial cell line)
- ASB for transcription factors
- HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | 0.44 | 3.13 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, diastolic blood pressure (dbp), height, longstanding arthritis, plasma renin activity, systolic blood pressure (sbp)