rs2270625 chr5:40834986 C>G
- Sequence
aaaggacacaatgcggctctagca[C/G]cacaattacggcgggataggtccc
- ASB in cell types
- primary B-CLL cells MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- ELF1_HUMAN BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | n/a | 3.14 | 3.00 | n/a | No Hit | |||
| BRD2_HUMAN | n/a | 2.08 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (geographic atrophy), barnes akathisia rating scale, diabetic retinopathy in type 2 diabetes mellitus, panic disorder, parkinsons disease, salmonella-induced pyroptosis, tardive dyskinesia, urinary albumin-to-creatinine ratio