rs2271048 chr12:122850936 A>G
- Sequence
gtgagtcactctgcatggctacat[A/G]gccagttcccctcggcttccccat
- ASB in cell types
- MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
- ASB for transcription factors
- CDN1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDN1B_HUMAN | 1.29 | -0.23 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Coronary, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg