rs2271821 chr12:51270363 A>G
- Sequence
gtcgcggaggccagcagaggccga[A/G]cgaggaccccgagcggaggaagcc
- ASB in cell types
- HEK293 (embryonic kidney) SMMC-7721 (hepatocellular carcinoma) breast tumor
- ASB for transcription factors
- PTEN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PTEN_HUMAN | -1.71 | 2.09 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Cells_Cultured_fibroblasts, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Whole_Blood