rs2272730 chr8:27774626 C>T
- Sequence
gcgcaggtaacctctggagtaggc[C/T]gaggcggggggctgtggaaggctg
- ASB in cell types
- HEK293 (embryonic kidney) HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- ZFX_HUMAN INT11_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 1.27 | -0.12 | 1.00 | -4.53 | Concordant | |||
| INT11_HUMAN | 1.63 | -0.32 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood