rs2272867 chr1:209756234 C>A
- Sequence
tacccatctgctgtcttgctccat[C/A]tgagaccagagccaagatctgccc
- ASB in cell types
- primary B-CLL cells CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.87 | -4.33 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.71 | 1.08 | 1.00 |
Items per page:
1 – 2 of 2