rs2273881 chr1:185156912 G>A
- Sequence
agaaaacagaaagccagaggcagc[G/A]attccagatgcccgtccgcttccc
- ASB in cell types
- CD14+ monocytes MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.88 | 0.23 | 1.92 | n/a | No Hit | |||
| STAT1_HUMAN | 3.12 | 1.23 | 1.25 | n/a | No Hit |
Items per page:
1 – 2 of 2