rs2274748 chr9:122213873 G>C
- Sequence
gcgggactgcctcgtcgcctcctg[G/C]agaaggatggccacgtgcacgcac
- ASB in cell types
- HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- INT11_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| INT11_HUMAN | 1.98 | -1.38 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1