rs227727 chr17:56699594 A>T
- Sequence
cctgggaccgaggacaggagggat[A/T]aagggagctcttctctgacactcc
- ASB in cell types
- A549 (lung carcinoma) HUES64 (embryonic stem cells) BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | n/a | 2.76 | 1.00 | 6.14 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
