rs2278851 chr2:133641669 T>C
- Sequence
ccctcaggccatggcccagagaga[T/C]tgttctgggaggctgtggttcatc
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma) MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- GATA3_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 2.83 | -0.05 | 1.25 | n/a | No Hit | |||
| ANDR_HUMAN | 2.45 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2