rs2278990 chr15:51622465 G>A
- Sequence
ctcccggccgccgctcaccgtgaa[G/A]gggacatccccgacgctgcccacg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.79 | 0.42 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), triglycerides, waist hip ratio
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Substantia_nigra, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood