rs2280039 chr2:219498766 A>G
- Sequence
cccgccccgcgatcccttggtcac[A/G]cccctggacttcagcacctctttc
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
- ASB for transcription factors
- PAX5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX5_HUMAN | -2.02 | 1.89 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, serum creatinine, waist hip ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid