rs2280283 chr4:151099625 C>T
- Sequence
taagttctcgcgcgactcccactt[C/T]cgcccttttggctctctgaccagc
- ASB in cell types
- K562 (myelogenous leukemia) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 2.40 | -1.43 | 2.00 | |||
| primary B-CLL cells | 2.24 | n/a | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood