rs228097 chr21:42561831 C>T
- Sequence
ggccgaggagctgcagctggggcc[C/T]cacccttctcagaggccccgcccc
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.98 | 0.35 | 1.06 | |||
| MS-1 (Small cell lung carcinoma) | 1.79 | -1.54 | 1.33 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.22 | 1.67 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood