rs2282174 chr3:119463512 A>G
- Sequence
aaggtgtccaggcttcgggctgcc[A/G]gactcagacccagactccgacgca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) breast tumor HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.66 | 0.78 | 1.16 | |||
| breast tumor | 2.73 | n/a | 2.00 | |||
| HepG2 (hepatoblastoma) | 1.24 | -1.31 | 1.50 |
Items per page:
1 – 3 of 3