rs2283590 chr19:940674 A>T
- Sequence
ggtcaggcagcaggttccgagcac[A/T]cagaggcagcggctgtgtttgaga
- ASB in cell types
- primary B-CLL cells breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.56 | n/a | 3.00 | |||
| breast tumor | 2.10 | -0.48 | 2.00 |
Items per page:
1 – 2 of 2