rs2286896 chr2:190670850 T>C
- Sequence
tagaatggtcctttttgcaaggtg[T/C]ttgaatctgatgagattagctgaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | n/a | 2.38 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, aspirin-exacerbated respiratory disease, endometriosis, hypertension (early onset hypertension), ldl cholesterol, percent decrease of forced expiratory volume (fev) for 1 month after aspirin challenge, primary biliary cirrhosis, rheumatoid arthritis, tetrology of fallot, total cholesterol, total cholesterol change with statins, triglycerides, triglycerides change with statins, years of education
GTEx eQTL Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid