rs2287015 chr14:75579019 T>C
- Sequence
aggaagagagcgatgacacccctg[T/C]gccggagtccgcactccaagcgga
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- HMGB1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HMGB1_HUMAN | 2.90 | n/a | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.28 | 0.76 | 1.10 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood