rs2287554 chr12:108562581 C>T
- Sequence
gccgactcgcagacgcgccccgcc[C/T]ctcggcgtcgctctggactggcgc
- ASB in cell types
- fetal bone marrow-derived mononuclear cells upper lobe of left lung tibial nerve MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
- ASB for transcription factors
- MEN1_HUMAN BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEN1_HUMAN | 2.79 | n/a | 2.00 | n/a | n/a | |||
| BRD2_HUMAN | 1.36 | 0.50 | 1.07 | n/a | n/a |
Items per page:
1 – 2 of 2