rs2288661 chr6:122610275 G>T
- Sequence
cgtgccccggggagtgatgcggtg[G/T]cccggtttgcacggagagcgggac
- ASB in cell types
- 22RV1 (prostate carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.73 | 0.15 | 1.50 | |||
| foreskin keratinocyte | 1.20 | n/a | 2.67 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Nerve_Tibial, Whole_Blood