rs2301823 chr17:56961129 C>A
- Sequence
ggcgtgtgccacctagtggtgaaa[C/A]ctggctactacaggctgcgtctag
- ASB in cell types
- neutrophils from periferal blood CD14+ monocytes T47D (invasive ductal carcinoma) A549 (lung carcinoma)
- ASB for transcription factors
- STAT1_HUMAN OSR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -1.04 | 1.88 | 3.00 | n/a | No Hit | |||
| OSR2_HUMAN | 2.56 | -4.79 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood