rs2304952 chr18:11908721 A>G
- Sequence
gctgaagggcgggggacgcgggaa[A/G]ggcattttggggacacaggagagc
- ASB in cell types
- primary B-CLL cells pancreas upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.39 | -4.36 | 2.50 | |||
| pancreas | -1.85 | 2.15 | 1.00 | |||
| upper lobe of left lung | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood