rs2306204 chr12:69359750 C>A
- Sequence
cggtgcggccgtcgcccctctttt[C/A]gcggcgttctccacctgcgcgggc
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) MOLM14 (Adult acute myeloid leukemia) CD14+ monocytes
- ASB for transcription factors
- TYY1_HUMAN NELFA_HUMAN BRD4_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 1.69 | 0.77 | 1.71 | n/a | No Hit | |||
| NELFA_HUMAN | -3.38 | 1.54 | 2.00 | n/a | n/a | |||
| BRD4_HUMAN | 1.86 | -0.15 | 2.00 | n/a | n/a | |||
| STAT1_HUMAN | 2.21 | 0.65 | 1.33 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-ir, infant head circumference, mitral annular calcium, spatial working memory strategy, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood