rs2310241 chr2:102225489 A>C
- Sequence
ttacaatatgattgtaatcaagaa[A/C]gggcagcagaaccagctggagaag
- ASB in cell types
- neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -1.66 | 2.61 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood