rs231551 chr2:88880498 C>G
- Sequence
gaagaaatgataccccggagcttt[C/G]agaccagagactcccgagttacac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.08 | 0.73 | 1.33 | n/a | No Hit | |||
| STAG1_HUMAN | 2.81 | 0.46 | 1.42 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Spleen, Stomach, Whole_Blood