rs2324704 chr3:76933008 G>A
- Sequence
ggaacactttgcttgttaggatga[G/A]gatattctttttaaacctctgaaa
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.14 | 1.68 | 1.27 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, alzheimers disease, hdl cholesterol, hypertension (early onset hypertension)