rs232561 chr2:38168874 A>G
- Sequence
gaagattacacaattaggacgtgt[A/G]aggatatgattcagggtgtgtctg
- ASB in cell types
- keratinocytes JB6 (Human anaplastic large cell lymphoma) SU-DHL-1 (Anaplastic large cell lymphoma)
- ASB for transcription factors
- CEBPB_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 1.86 | -2.22 | 1.50 | n/a | No Hit | |||
| SNAI2_HUMAN | 2.00 | -3.80 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood