rs232605 chr2:38148789 G>C
- Sequence
ctcctcgccatgagaactaagtca[G/C]tctcccagtgccaggagccaggac
- ASB in cell types
- macrophages A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | n/a | 2.31 | 2.50 | |||
| A549 (lung carcinoma) | -0.08 | 0.92 | 1.19 |
Items per page:
1 – 2 of 2