rs2331649 chr8:97831827 G>A
- Sequence
tgggcgcagacgtttccttgggca[G/A]tggggtcagatgttttttggtgcc
- ASB for transcription factors
- GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 0.07 | 0.87 | 2.15 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Nucleus_accumbens_basal_ganglia, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Thyroid