rs2335230 chr1:154617152 A>C
- Sequence
tcctgtcctgcttgttgcttagac[A/C]atgcctagtccagataacactggc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.35 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, bipolar disorder, chronic kidney disease, late onset alzheimers disease, rheumatoid arthritis, soluble il6r (sil6r)