rs2337127 chr15:29614015 A>C
- Sequence
tcagtgtgcagaacaagagtcgcc[A/C]gcagctatttcatggaatggatgc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.62 | 2.01 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, childhood acute lymphoblastic leukemia, cystatin c in serum, depressive symptoms , hdl cholesterol, hip bone mineral density (bmd), homa-b, infant head circumference, obesity with early age of onset (age >2)