rs2340943 chr14:55051289 C>T
- Sequence
acttttggcccgaggatctgagtc[C/T]tcgggtcaggccgaaatcagaccg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) HEK293T (embryonic kidney) MDA-MB-231 (breast adenocarcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.42 | 0.88 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), circulating galectin-3 levels, hypertension (early onset hypertension), parkinsons disease, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adrenal_Gland, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis