rs2343295 chr7:132846210 G>A
- Sequence
gtcttgctctgggcaccagaatac[G/A]acaacagtgatggtgtaccagttt
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -4.37 | 2.57 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, biploar disorder (bipolar schizoaffective disorder), mitral annular calcium, obesity with early age of onset (age >2), simpson-angus scale